资源描述：
jwxt 22 February 2016 35 2 1 11 Http Mycosystema ISSN1672 6472 CN11 5180 Q Tel 86 10 64807521 Copyright 2016 Institute of Microbiology CAS all rights reserved 8 Review DOI 10 13346 j mycosystema 150162 S E 1 S 31170098 Z g S 13391912202 Z g g j g d M 9 j 3 2015 1 9 Supported by the National Natural Science Foundation of China 31170098 the Chongming Special Projects of Science and Technology Commission of the Shanghai Municipality 13391912202 Growing Program for the Young Talents of the Shanghai Agriculture Committee 2015 1 9 Corresponding author E mail syj0 Received 2015 07 20 accepted 2015 11 02 P c y 0 V r s v D a 1 S E J j 7 b L i Z g j L 7 b L i Z g j 1997 b 2 3 H v 1 p L 0 L 8 b 2008 3 Y b Sakamoto et al 2007 s c s Y T V B PSH pileus specific hydrophobin 1 T b B Y m i i c F RNA Seq Y V c F s P V c y 0 V r z L P s 0 9 F L Y J 3 M i J 4 b 1 Z E 1 1 k P 135 S j I ACCC50903 b 1 2 P Z 80 20 850 X A c 65 b E 22 30d 3 V T 118 b z s s k F B F b 24h E H q 6 B F b 12h v 12h H q P c y 0 V r s 3 300lux P V P v 50d H F V T 313W 313C b 1 3 9 RNA 4 a B cDNA o y TRIzol k 4 Invitrogen S 4 9 RNA i RNA 1 3 s d Agilent Technologies 2100 Bioanalyze V L b v S Illumina 3 k 4 mRNA Seq SamplePreparation Kit Z E y c F cDNA o 3 3 RNA 50 L RNA Seq c F b 1 4 c F P RNA 4 a o y Illumina HiSeq 2000 Y o c F 8 I Tang et al 2013 Z E b 1 5 c F s S V r P Trinity version trinityrnaseq 03122011 q V h F Y V q TGICL S K Unigene i O RPKM E Reads Per kb per Million reads Mortazavi et al 2008 b E 118 313W T v v H q 3 313C FDR 0 001 O s 2 y l s V r y b Y V Blastx 1 evalue 0 00001 1 o s Y Nr aSwiss Prot aKEGG COG Unigene d K M i O K D d M Unigene Tang et al 2013 b 1 6 T o 1 c y 0 s 313C 313W a118 1 s s y Y V tblastx T E 2 o TAIR 10 http www arabidopsis org 1 E value 1e 4 c y 0 y 1 T V s V r y T 1 1 c y 0 b 1 7 L H PCR s 4 s V r 5 c y 0 y L H PCR s RNA TaKaRa k 4 S v Q c cDNA 18S rRNA y QIAGEN SYBR Green RT PCR k 4 7500 PCR N Applied Biosystems Foster City CA USA b y 3 Q M CT E Livak L v 3 C 80 c y 0 c 118 1 V r 3 M V r c y 0 y 49 0 0113 4 9635 W K v y Unigene8208 cryptochrome DASH M r 4 9635 b c V r 31 0 0184 9 469 c K v Unigene8209 DASH family cryptochrome 9 469 V 1 b 313W M 1 313C 68 c y 0 c V r 3 M b V r c y 0 y 48 0 0656 4 591 W K v y Unigene488 transcription factor GATA transcription factor ISSN1672 6472 CN11 5180 Q Mycosystema February 22 2016 Vol 35 No 2 http journals 4 12 M r 4 591 b c V r 20 V r M 0 1116 8 5611 W b c K v Unigene8209 DASH family cryptochrome 8 5611 V 1 b 6 8 c y 0 M V 2 U b V 1 P 1 313C 118 313C 313W M V 2 c y 0 y Table 1 List of the transcription factors transcripted with over 2 fold variations between the samples 313C 118 and 313C 313W 1 Sample for comparison y ID gene ID Nr d Nr annotation V r M Difference of express E 2 e Arath short description 313C 118 Unigene13384 RCC1 domain containing protein 1 208 4 WD 40 repeat family protein Unigene441 transcription factor TFIIH complex subunit Tfb2 1 062 6 transcription factor related Unigene442 transcription factor TFIIH complex subunit Tfb2 1 004 8 transcription factor related Unigene7952 transcription initiation factor TFIIE alpha subunit 1 008 9 Transcription factor TFIIE alpha subunit Unigene15779 Jmjd1a protein 1 339 Transcription factor jumonji jmjC domain containing protein Unigene21566 C2H2 finger domain protein FlbC 1 126 8 transcription factor IIIA Unigene5372 Pc12g07060 4 045 7 transcription factor IIIA Unigene28772 transcription factor TFIIH complex subunit Rad15 2 934 RAD3 like DNA binding helicase protein Unigene10863 transcription factor TFIIH complex subunit Rad15 2 065 3 RAD3 like DNA binding helicase protein Unigene2467 CHL1 helicase 1 541 7 RAD3 like DNA binding helicase protein Unigene19077 DEAD 2 domain protein 1 126 9 RAD3 like DNA binding helicase protein Unigene1597 related to triacylglycerol lipase 1 095 6 protein phosphatase 5 2 Unigene29412 related to c myb like protein 2 127 3 myb domain protein 4r1 Unigene8719 related to c myb like protein 1 929 4 myb domain protein 3r 3 Unigene19369 related to c myb like protein 2 194 3 myb domain protein 3r 3 Unigene30301 MADS box transcription factor 2 185 7 K box region and MADS box transcription factor family protein Unigene23564 MADS box transcription factor 1 720 9 K box region and MADS box transcription factor family protein Unigene20377 MADS box transcription factor 1 875 K box region and MADS box transcription factor family protein Unigene4388 GATA zinc finger domain containing protein 1 167 4 GATA transcription factor 27 P c y 0 V r s 5 V 1 Unigene10638 transcription factor GATA 4 1 847 2 GATA transcription factor 13 Unigene488 transcription factor 4 591 GATA transcription factor 12 Unigene8208 cryptochrome DASH 4 963 5 cryptochrome 3 Unigene903 L carnitine dehydratase bile acid inducible protein F 1 226 3 cryptochrome 3 Unigene8210 cryptochrome DASH 1 747 1 cryptochrome 3 Unigene21495 DASH family cryptochrome 5 173 9 cryptochrome 3 Unigene8207 cryptochrome DASH 5 902 1 cryptochrome 3 Unigene21494 DASH family cryptochrome 6 127 2 cryptochrome 3 Unigene8209 DASH family cryptochrome 9 469 cryptochrome 3 313C 313W Unigene11618 WD 40 repeat family protein Unigene26795 transcription factor TFIIH complex subunit Tfb2 1 863 1 transcription factor related Unigene15779 Jmjd1a protein 1 412 8 Transcription factor jumonji jmjC domain containing protein Unigene10301 jumonji superfamily protein 1 057 4 Transcription factor jumonji jmj family protein zinc finger C5HC2 type family protein Unigene21566 C2H2 finger domain protein FlbC 1 898 6 transcription factor IIIA Unigene1596 cell surface flocculin 1 220 1 transcription factor IIIA Unigene5372 Pc12g07060 4 806 6 transcription factor IIIA Unigene19023 transcription factor TFIIH complex subunit Rad15 1 486 RAD3 like DNA binding helicase protein Unigene28772 transcription factor TFIIH complex subunit Rad15 1 313 9 RAD3 like DNA binding helicase protein Unigene10863 transcription factor TFIIH complex subunit Rad15 1 292 8 RAD3 like DNA binding helicase protein Unigene3059 CHL1 helicase 1 268 RAD3 like DNA binding helicase protein Unigene18375 uv excision repair protein rhp23 1 155 3 Rad23 UV excision repair protein family Unigene1597 related to triacylglycerol lipase 1 588 3 protein phosphatase 5 2 Unigene823 histone acetyltransferase 1 519 phosphotransferases alcohol group as acceptor binding inositol or phosphatidylinositol kinases Unigene30301 MADS box transcription factor 3 735 2 K box region and MADS box transcription factor family protein Unigene30302 MADS box transcription factor 2 898 6 K box region and MADS box transcription factor family protein ISSN1672 6472 CN11 5180 Q Mycosystema February 22 2016 Vol 35 No 2 http journals 6 V 1 Unigene23566 MADS box transcription factor 2 494 K box region and MADS box transcription factor family protein Unigene10529 MADS box transcription factor 2 615 7 K box region and MADS box transcription factor family protein Unigene20377 MADS box transcription factor 2 911 K box region and MADS box transcription factor family protein Unigene23564 MADS box transcription factor 3 631 K box region and MADS box transcription factor family protein Unigene4388 GATA zinc finger domain containing protein 1 617 2 GATA transcription factor 27 Unigene31371 blue light regulator 2 1 506 1 GATA transcription factor 13 Unigene10638 transcription factor GATA 4 1 908 7 GATA transcription factor 13 Unigene488 transcription factor 4 591 GATA transcription factor 12 Unigene17580 homeodomain transcription factor 1 876 1 FLOWERING WAGENINGEN Unigene4618 nime cyclinb 1 128 3 CYCLIN B2 4 Unigene17015 g2 mitotic specific cyclin cdc13 1 545 7 Cyclin B2 2 Unigene904 L carnitine dehydratase bile acid inducible protein F 1 024 3 cryptochrome 3 Unigene8210 cryptochrome DASH 1 645 2 cryptochrome 3 Unigene8208 cryptochrome DASH 1 908 1 cryptochrome 3 Unigene21494 DASH family cryptochrome 7 333 6 cryptochrome 3 Unigene8209 DASH family cryptochrome 8 561 1 cryptochrome 3 Unigene6856 photolyase 1 220 5 cryptochrome 2 Unigene11493 basic transcription factor 2 35KD subunit 2 898 7 basal transcription factor complex subunit related Note Fold log 2 Ratio V 2 P c y 0 M Table 2 The number and variation range of transcription factor genes when comparing the samples 313C 118 with 313C 313W 1 Sample for comparison V r y Up regulated genes V r y Down regulated genes y Gene number V r M S Expression variation range Mean y Gene number V r M S Expression variation range Mean 313C 118 49 0 0113 4 9635 0 8988 31 0 0184 9 469 1 739 313C 313W 48 0 0656 4 591 1 1425 20 0 1116 8 5611 2 1764 P c y 0 V r s 7 2 2 1 313C 118 313C 313W W s c y 0 313C 118 313C 313W W 1 s c y 0 c V r V C s m 1 b 313C 118 1 c y 0 c 26 V C s b c c 10 c c 16 b K v c y 0 Unigene 8208 cryptochrome DASH M 4 963 5 Q Unigene 29412 related to c myb like protein M 2 127 3 b K v c y 0 Unigene 8207 cryptochrome DASH M 5 902 1 Q Unigene 21495 DASH family cryptochrome M 5 173 9 b 313C 313W 1 14 s Y c y 0 c V Y c 20 59 b s c 9 s c 5 b Unigene 10301 jumonji superfamily protein Q K c V r 1 057 4 b I MADS box E B c y 0 c Unigene23566 s K v 2 494 b 2 3 1 313C 118 313C 313W W c y 0 313C 118 313C 313W 1 W 54 c y 0 s V r 1 i O s s V r c y 0 V r B m 1 b c 39 c V r 15 c V r b c V r c Unigene 6856 photolyase aUnigene 30301 MADS box transcription factor aUnigene 30302 MADS box transcription factor aUnigene 4388 GATA zinc finger domain containing protein c V r c Unigene 8209 DASH family cryptochrome b m 1 313C 118 313C 313W 1 s c y 0 Fig 1 Comparison of the number of specific and overlapping transcription factors beween the samples 313C 118 and 313C 313W 2 4 P V c y 0 s s c y 0 T V 3 V P V c y 0 E B s V r b s V r A O c c y 0 c y 0 E B WD40 aTFII aRAD aMADS box a MYB Gata b V V 3 V A RAD E B V r c y 0 K cryptochrome V r c y 0 K b c y 0 E B M 1 c c y 0 9 c c y 0 MADS box E B a Gata E B b 6 c y 0 E B MYB 313C 118 i c y 0 E B i 313C 118 V 3 1 b c y 0 E B 313C 118 313C 313W i t c y 0 V P 1 s 0 L b 2 5 L H PCR s B s c F s Y P MADS box E B c y 0 5 y L H PCR 313W 313C V r M s b Primer Premier 5 q 9 V 4 U T m 2 U 3 c y 0 c V r t c F s T V r t M b ISSN1672 6472 CN11 5180 Q Mycosystema February 22 2016 Vol 35 No 2 http journals 8 V 3 P 1 s V r c y 0 s Table 3 Comparison of categories of the transcription factors differentially expressed between the samples 313C 313W and 313C 118 c y 0 E B transcription factor family 313C 313W 313C 118 Number of up regulat ed genes 1 Percentage of up regulated genes Number of down regulated genes 1 Percentage of down regulated genes Number of up regulated genes 1 Percentage of up regulated genes Number of down regulated genes 1 Percentage of down regulated genes WD 40 3 6 25 0 0 2 4 18 1 3 45 TFII 3 6 25 2 9 52 3 6 25 2 6 90 Jumonji 7 14 58 1 4 76 5 10 42 3 10 34 TFIII 4 8 33 2 9 52 4 8 33 2 6 90 RAD 10 20 83 1 4 76 9 18 75 1 3 45 MADS box 3 6 25 4 19 06 4 8 33 3 10 34 GATA 5 10 42 1 4 76 4 8 33 2 6 90 cryptochrome 2 4 17 5 23 81 3 6 25 6 20 69 MYB 0 0 0 0 4 8 33 5 17 24 other 11 22 92 5 23 81 10 20 83 4 13 79 V 4 L H PCR Table 4 Primers for real time quantitative PCR analysis y IDUnigene ID d Putative function Primer 5 3 18S rRNA F AAACGGCTACCACATCCA R CACCAGACTTGCCCTCCA 11618 F box WD repeat containing protein 11 F GGTCATTTATCGTCGTCCTTTG R CCCAAGAGCAACAAGTCCG 30301 MADS box transcription factor F ATGCCTCCTCCGATGTGC R ATCACCATCGCCCTCACC 448 transcription factor F GGATTCTCCAGCGTTGTCTTC R TTGGGTGATGCGGGTTGA 17580 homeodomain transcription factor F AGCGTGAGACTGTAGCAAGAGC R GCGAGGAGTGACGAGGACA 21494 DASH family cryptochrome F AATCGCTGAAACACCGTAGAAG R TCGCCCTCTTCCTTCACG Note Specific primers of 11 experimentally validated unigene designed for qRT PCR using Primer Premier 5 0 3 c y 0 3 1 c e T Y 9 1 T b c F s C B s V r 1 c y 0 E B WD 40 aJumonji aMADS box a MYB aDEAD box aGATA V t c y 0 V P V 1 T b T V s V r c y 0 i O 1 c y 0 E B V r 9 V r 1 s c y 0 M 9 i s c y 0 V c y 0 P e H 9 b P c y 0 V r s 9 m 2 s c y 0 V r M real time PCR s c F s Fig 2 Comparison of the expression profiles of selected transcription factors examined by rea time PCR and transcriptome analysis V 4 L F J J e B 3 V y a Martin a Q Okanami et al 1998 Kant et al 2007 Macovei et al 2012 b DEAD box RNA y OsABP Y a H V C Wang et al 2005 b C P 9 DEAD box E B c y 0 c A s V r V DEAD box RNA V P a V s 3 b MYB c y 0 B v c y 0 E B s a y 0 s 3 V i Q 3 y 1 T Gao et al 2011 b B 1 Q 3 1 M 1 MYB c y 0 3 V 1 e T Stracke et al 2007 b K V Myb c y 0 V e T a T a 2 1 T Takos et al 2006 Ban et al 2007 Azuma et al 2008 b 6 v Myb c y 0 e Ban et al 2007 7 Aharoni et al 2001 b P MYB E B c y 0 9 V r M V MYB E B 1 1 y 0 b MADS box y E B 3 1 c e y 0 b MADS box V e c Alvarez Buylla et al 2000 Hog1 o 1 i Y Dodou P c y 0 V r s 11 621 628 Okanami M Meshi T Iwabuchi M 1998 Characterization of a DEAD box ATPase RNA helicase protein of Arabidopsis thaliana Nucleic Acids Research 26 11 2638 2643 Putterill J Laurie R Macknight R 2004 It s time to flower the genetic control of flowering time Bioessays 26 4 363 373 Rottmann M Dieter S Brunner H Rupp S 2003 A screen in Saccharomy cescerevisiae identified CaMCM1 an essential gene in Candida albicans crucial for morphogenesis Molecular Microbiology 47 4 943 959 Sakamoto Y Ando A Tamai Y Yajima T 2007 Pileus differentiation and pileus specific protein expression in Flammulina velutipes Fungal Genetics 0 L 8 3 Y S J 16 6 11 13 1984 3 Y 3 Y 4 147 148 f V 2003 P V C J 25 1 2 4 3 I b
展开阅读全文
